View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19658_low_66 (Length: 306)
Name: NF19658_low_66
Description: NF19658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19658_low_66 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 27 - 294
Target Start/End: Original strand, 10322500 - 10322755
Alignment:
| Q |
27 |
attaaagctagcttctttttcttcttgctttctcttttattgagctgataccatttaggagcatgttttattataaagaaatgttattagttctcataaa |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10322500 |
attaaagctagcttctttttcttcttgctttctcttttattgagctgataccatttaggagcatgttttattataaagaaatgttagtagttctcataa- |
10322598 |
T |
|
| Q |
127 |
cggaagcttttacggttatgttattttttgagtaaaaaattgaccacatatctatctatgccctttannnnnnnactaaagacattcattcttttactgt |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
10322599 |
-----------acggttatgttattttttgagtaaaaaattgaccacatatctatctatgccttttttttttttactaaagacatccattcttttactgt |
10322687 |
T |
|
| Q |
227 |
caaaaatgggtagaaaaagaataatgcaccgactttttgttttgacaaaaattacaccgaccaagaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10322688 |
caaaaatgggtagaaaaagaataatgcaccgactttttgttttgacaaaaattacaccgaccaagaat |
10322755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University