View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19658_low_75 (Length: 292)
Name: NF19658_low_75
Description: NF19658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19658_low_75 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 17 - 280
Target Start/End: Original strand, 50490585 - 50490848
Alignment:
| Q |
17 |
gttacaactcccccaattcgaatcattgtattcaaatggatctgcctgctcgatataaggcagctattagtttttcatccaatggaagacataggagtgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50490585 |
gttacaactcccccaattcgaatcattgtattcaaatggatctgcctgctcgatataaggcagctattagtttttcatccaatggaagacataggagtgt |
50490684 |
T |
|
| Q |
117 |
aatatatcagttggttttttaaagttacctgatatttcgaatctggtcataaaccggtaagttggtaatgcgaacatatatcttttgatgtatatgtttg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50490685 |
aatatatcagttggttttttaaagttacctgatatttcgaatctggtcataaaccggtaagttggtaatgcgaacatatatcttttgatgtatatgtttg |
50490784 |
T |
|
| Q |
217 |
taattggcatgcaagttaaagacaacacttttagcaacatcttccattacttctaaaacagaat |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50490785 |
taattggcatgcaagttaaagacaacacttttagcaacatcttccattacttctaaaacagaat |
50490848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University