View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19658_low_79 (Length: 283)
Name: NF19658_low_79
Description: NF19658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19658_low_79 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 264
Target Start/End: Complemental strand, 44991066 - 44990803
Alignment:
| Q |
1 |
atgttcactgtgacatacacaggagatcataaccatgcaagacctacccatcggaactcactagccggaagtacacgaaccaagtctccggtgacacatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
44991066 |
atgttcactgtgacatacacaggagatcataaccatgcaagacctacccatcggaactcactagccggtagtacacgaaccaagtctccggtgacacatc |
44990967 |
T |
|
| Q |
101 |
caaccacttcaatttctggtcaacccaacagttcaatttcttcttgctcttctttagcaccaaactcttttgctgaagaagaagaagacatcgacatgga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44990966 |
caaccacttcaatttctggtcaacccaacagctcaatttcttcttgctcttctttagcaccaaactcttttgctgaagaagaagaagacatcgacatgga |
44990867 |
T |
|
| Q |
201 |
aattgaaactgatgatgatggtgaagatagttgtgatattccttcctaaccatgaccaaggaag |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44990866 |
aattgaaactgatgatgatggtgaagatagttgtgatattccttcctaaccatgaccaaggaag |
44990803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University