View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19658_low_83 (Length: 265)
Name: NF19658_low_83
Description: NF19658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19658_low_83 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 11 - 249
Target Start/End: Complemental strand, 51320609 - 51320365
Alignment:
| Q |
11 |
aagaaacactattcattaggtacaaataacttaacgggccatcatttagattcattgctctctctct--------------gataccaccagagtttaat |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
51320609 |
aagaaacactattcattaggtacaaataacttaacgggccatcatttagattcattgctctctctctctctctctctctctgataccaccagagtttaat |
51320510 |
T |
 |
| Q |
97 |
tatgtcaaatcccaattcaattactattccctcatcagctcctgaggacggtacgtttgtttaacaacatcccaacctatgtatgtatgtatttctatat |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| | |
|
|
| T |
51320509 |
tatgtcaaatcccaattcaattactattccctcatcagctcctgaggacggtacgtttgtttaacaacatcccaacctatgtat----gta----tatct |
51320418 |
T |
 |
| Q |
197 |
atatatttcacaggaaccttgatgtctatttttgtagtgcgacctcatcatct |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51320417 |
atatatttcacaggaaccttgatgtctatttttgtagtgcgacctcatcatct |
51320365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University