View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19658_low_84 (Length: 262)
Name: NF19658_low_84
Description: NF19658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19658_low_84 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 13 - 247
Target Start/End: Complemental strand, 6232828 - 6232591
Alignment:
| Q |
13 |
gagaggaactccgatgattatgtcaccagaagcagtgaatgatagtgtttatgaatcgccagccgatatatgggctcttggttgcgccgtcgtggagatg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6232828 |
gagaggaactccgatgattatgtcaccagaagcagtgaatgatagtgtgtatgaatcgtcagccgatatatgggctcttggttgcgccgtcgtggagatg |
6232729 |
T |
 |
| Q |
113 |
attaccggagaac---ccgcatggaatgagtcagatatgttaatgttgacgattcgaattggggttggagaagaattgccaaagattccagacgaattat |
209 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||| |||||||||||||||||||| |||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
6232728 |
attaccggagaacccgccgcatggaatgaatcagatatgttgatgttgacgattcgaattggtgttggagaagaattgccaaaaattccagaggaattat |
6232629 |
T |
 |
| Q |
210 |
cacaagaaggaaaagattttctagaaaagtgtttcatt |
247 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6232628 |
cacaagaaggaaaagattttttagaaaagtgtttcatt |
6232591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 31 - 112
Target Start/End: Complemental strand, 6222034 - 6221953
Alignment:
| Q |
31 |
tatgtcaccagaagcagtgaatgatagtgtttatgaatcgccagccgatatatgggctcttggttgcgccgtcgtggagatg |
112 |
Q |
| |
|
||||||||||||||| ||||| || |||||||||||||| || || ||||||||||||||||||||||| | ||||||||| |
|
|
| T |
6222034 |
tatgtcaccagaagcggtgaacgagagtgtttatgaatcaccggcagatatatgggctcttggttgcgctattgtggagatg |
6221953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 193 - 246
Target Start/End: Complemental strand, 6221863 - 6221810
Alignment:
| Q |
193 |
gattccagacgaattatcacaagaaggaaaagattttctagaaaagtgtttcat |
246 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
6221863 |
gattccagatgaattatcacaagtcggaaaagattttctcgaaaagtgtttcat |
6221810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University