View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19658_low_87 (Length: 253)

Name: NF19658_low_87
Description: NF19658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19658_low_87
NF19658_low_87
[»] chr2 (1 HSPs)
chr2 (21-241)||(30898973-30899192)


Alignment Details
Target: chr2 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 21 - 241
Target Start/End: Complemental strand, 30899192 - 30898973
Alignment:
21 taaggacactagttaccatttaaaataaataaataaaatattcggtgttgacaagtaatcacgactcatggttgnnnnnnnatatctaaatgggccataa 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||    
30899192 taaggacactagttaccatttaaaataaataaataaaatattcggtgttgacaagtaatcacgactcatggttgttttttt-tatctaaatgggccataa 30899094  T
121 ctggaaaatcaccgaccacaaaatttcaatttaaccatctgagttagccagcttatagagacaaaaccataaatagactgagagcaatttatggggtgtc 220  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||    
30899093 ctggaaaatcaccgaccacaaaattccaatttaaccatctgagttagccagcttatagagacaagaccataaatagaccgagagcaatttatggggtgtc 30898994  T
221 acatgttttgtatgtgagaat 241  Q
    |||||||||||||||||||||    
30898993 acatgttttgtatgtgagaat 30898973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University