View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19658_low_93 (Length: 248)
Name: NF19658_low_93
Description: NF19658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19658_low_93 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 43 - 237
Target Start/End: Original strand, 1636919 - 1637113
Alignment:
| Q |
43 |
gtgatagaacgtaaaaattcaactgagaaacatttgtttactatgatgttttaagtaatggtactgacatcgctgaagtataattcaagttttccaaaga |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1636919 |
gtgatagaacgtaaaaattcaactgagaaacatttgtttactatgatgttttaagtaatggtactgacatcgctgaagtataattcaagttttccaaaga |
1637018 |
T |
 |
| Q |
143 |
cactataatgaaaatttgcaacaagtcaaataggatggatttgtttcttaaatgttcacgactgcataatcatgctcacatggatatggtatatt |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1637019 |
cactataatgaaaatttgcaacaagtcaaataggatggatttgtttcttaaatgttcacgactgcataatcatgctcacatggatatggtatatt |
1637113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University