View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19658_low_94 (Length: 247)
Name: NF19658_low_94
Description: NF19658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19658_low_94 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 232
Target Start/End: Complemental strand, 11103930 - 11103715
Alignment:
| Q |
18 |
ttaggatccaataagttaacgttgggagttaaaaatgctataatgcattgactaaa-tcatatttaaatctaaattttatttgaagtgtatcggtatagt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
11103930 |
ttaggatccaataagttaacgttgggagttaaaaatgctataatgcattgactaaaatcatatttaaatctttattttatttgaagtgtatcggtatagt |
11103831 |
T |
|
| Q |
117 |
tgattattgaattccactgaaaatcttatagacgacatgagagcattcattttttccttgcaaacatgattaggcttcttttataatagacgaattaagg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
11103830 |
tgattattgaattccactgaaaatcttatagacgacataagagcattcattttttccttgcaaacatgattaggcttcttttatcatagacgaattaagg |
11103731 |
T |
|
| Q |
217 |
aatcgatcgaacctat |
232 |
Q |
| |
|
||| |||||||||||| |
|
|
| T |
11103730 |
aatagatcgaacctat |
11103715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University