View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19659_high_5 (Length: 327)
Name: NF19659_high_5
Description: NF19659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19659_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 6e-65; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 165 - 298
Target Start/End: Original strand, 34337012 - 34337145
Alignment:
| Q |
165 |
aagaatggtgctgaattgttgatgaattacgacatagcatcccttttgatgtgtttggcttgttctgcattttgtttagttctaattggattatgaagca |
264 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34337012 |
aagaatggtgctgaattgttgatgaattatgacatagcatcccttttgatgtgtttggcttgttctgcatttcgtttagttctaattggattatgaagca |
34337111 |
T |
 |
| Q |
265 |
cggacactcctcagattaagcgtatccacttatc |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
34337112 |
cggacactcctcagattaagcgtatccacttatc |
34337145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 256 - 310
Target Start/End: Complemental strand, 18966627 - 18966573
Alignment:
| Q |
256 |
tatgaagcacggacactcctcagattaagcgtatccacttatcggacacgtgttg |
310 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||| || |||||||||||||| |
|
|
| T |
18966627 |
tatgaagcacggacactccttagattaggcgtatcccgttgtcggacacgtgttg |
18966573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000007; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 291
Target Start/End: Original strand, 37328776 - 37328811
Alignment:
| Q |
256 |
tatgaagcacggacactcctcagattaagcgtatcc |
291 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37328776 |
tatgaagcacggacactcctcggattaagcgtatcc |
37328811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 256 - 308
Target Start/End: Original strand, 32766873 - 32766925
Alignment:
| Q |
256 |
tatgaagcacggacactcctcagattaagcgtatccacttatcggacacgtgt |
308 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| | |||||||||||| |
|
|
| T |
32766873 |
tatgaagcacggacactcctcagattagacgtatcctggtgtcggacacgtgt |
32766925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000007; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 287
Target Start/End: Original strand, 17705547 - 17705578
Alignment:
| Q |
256 |
tatgaagcacggacactcctcagattaagcgt |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
17705547 |
tatgaagcacggacactcctcagattaagcgt |
17705578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 256 - 308
Target Start/End: Complemental strand, 37598949 - 37598897
Alignment:
| Q |
256 |
tatgaagcacggacactcctcagattaagcgtatccacttatcggacacgtgt |
308 |
Q |
| |
|
||||||||||||||||||||| ||||| |||| ||| || |||||||||||| |
|
|
| T |
37598949 |
tatgaagcacggacactcctcggattaggcgtgtcccattgtcggacacgtgt |
37598897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University