View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19659_high_8 (Length: 257)
Name: NF19659_high_8
Description: NF19659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19659_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 30 - 232
Target Start/End: Original strand, 11649166 - 11649368
Alignment:
| Q |
30 |
tcatttgaagcatatgtaaaataactttgctatagaatatactaattaaatcctttattttaaggctatgaaaaactataaagcaaaccacttcatatag |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11649166 |
tcatttgaagcatatgtaaaataactttgctatagaatatcctaattaaatcctttattttaaggctatgaaaaactataaagcaaaccacttcatatag |
11649265 |
T |
 |
| Q |
130 |
ctaataagtccccctctcagnnnnnnnnctaacaagtctaaaatctggttagcatatcatagtgtgtctaagctaactaatctgctataaccttgcatag |
229 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11649266 |
ctaataagtccccctctcagaaaaaaaactaacaagtctaaaatctggttagcatatcatagtgtgtctaagctaactaatctgctataaccttgcatag |
11649365 |
T |
 |
| Q |
230 |
agt |
232 |
Q |
| |
|
||| |
|
|
| T |
11649366 |
agt |
11649368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University