View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19659_low_3 (Length: 377)
Name: NF19659_low_3
Description: NF19659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19659_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 326; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 17 - 362
Target Start/End: Original strand, 16385386 - 16385731
Alignment:
| Q |
17 |
gagaggaaaagaatcaatgaagtaaaagcgataacaatagcaaaaacagcgattttgctaggcttcattttgtggatccatggtggtgaaagagttgatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
16385386 |
gagaggaaaagaatcaatgaagtaaaagcgataacaatagcaaaaacagcgattttgctaggcttcattttgtggatccacggtggtgaaagagttgatt |
16385485 |
T |
 |
| Q |
117 |
tggaatggaaatgataacatacaaactgttttttcgtgtctgatgaattgaaaccacagaaaccattgttgttgttgatgcaatctttacagcttgtgaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
16385486 |
tggaatggaaatgataacatacaaactgttttttcgtgtctgatgaattgaaaccacagaaaccattgttgttgttgatgcattctttacagtttgtgaa |
16385585 |
T |
 |
| Q |
217 |
gtaagtgtcttgtgttaaagcttcatcccactcaagttcaataccttggattagtatttcattgaggtaaacaagaacatcactttgacaactaggttca |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
16385586 |
gtaagtgtcttgtgttaaagcttcatcccactcaagttcaataccttggattagtatttcattgaggtaaacaagaacatcactttggcagctaggttca |
16385685 |
T |
 |
| Q |
317 |
ttgtctgaaacagaatgatgcatggatctacagcttttgaagattt |
362 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16385686 |
ttgtctgaaacagaatgatgcatggatctacagcttttgaagattt |
16385731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University