View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1965_high_17 (Length: 201)
Name: NF1965_high_17
Description: NF1965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1965_high_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 2e-75; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 2e-75
Query Start/End: Original strand, 19 - 186
Target Start/End: Original strand, 14362240 - 14362408
Alignment:
| Q |
19 |
aaagcgaaaatataatattatcttgtcataagaaaaatattacattgttattagttatcacatattgggtcgactttcttgtatg--tatatgctaggtt |
116 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
14362240 |
aaagcgataatataatattatcttgtcataagaaaaatattacattgttattagttatcacatattgggtcgactttgttgtatgtatatatgctaggtt |
14362339 |
T |
 |
| Q |
117 |
tcaaatcatttttgataaatagtttttagaaaaggaaattttgatgggaccctcccttcaaacatgtggt |
186 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14362340 |
tcaaatcatttttgataaatagtttttag-aaaggaaattttgatgggaccctcccttcaaacatgtggt |
14362408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University