View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1965_high_5 (Length: 391)
Name: NF1965_high_5
Description: NF1965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1965_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 368; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 368; E-Value: 0
Query Start/End: Original strand, 1 - 380
Target Start/End: Complemental strand, 15116424 - 15116045
Alignment:
| Q |
1 |
tttcaaagctggaacaactatgtttctgctctttcacaaacatggttaaggttcaaggatcgtgttcagaccagatcagacgatgccactgagacacatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
15116424 |
tttcaaagctggaacaactatgtttctgctctttcacaaacatggttaaggttcaaggatcgtgttcagaccagatcagatgatgccactgagacacatg |
15116325 |
T |
 |
| Q |
101 |
agcttaagaaacaaagtgagaatgaaatgaaaaaatgtctcaattggtgggacttgatttggtttggctttggtgcagtaattggtgcaggaatctttgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15116324 |
agcttaagaaacaaagtgagaatgaaatgaaaaaatgtctcaattggtgggacttgatttggtttggctttggtgcagtaattggtgcaggaatctttgt |
15116225 |
T |
 |
| Q |
201 |
gctaactggtcaagaagctcataaccatgcaggagcagcaatagttttatcctatgtagcttcaggaatatcagcaatgctttctgttttttgttacaca |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15116224 |
gctaactggtcaagaagctcataaccatgcaggagcagcaatagtcttatcctatgtagcttcaggaatatcagcaatgctttctgttttttgttacaca |
15116125 |
T |
 |
| Q |
301 |
gaatttgccgttgaagttccagctgcaggtggttcatttgcttatctaagaattgaattaggtgactttgttgctttcat |
380 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15116124 |
gaattcgccgttgaagttccagctgcaggtggttcatttgcttatctaagaattgaattaggtgactttgttgctttcat |
15116045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University