View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1965_low_11 (Length: 376)
Name: NF1965_low_11
Description: NF1965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1965_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 339; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 11 - 361
Target Start/End: Complemental strand, 41276277 - 41275927
Alignment:
| Q |
11 |
cataggcccaccaagcgagttcgccatagaaagaatcatcgaaacttttattgggctttcatgttctatttttgtggatcttcttttttggcccaaaagg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41276277 |
cataggcccaccaagcgagttcgccatagaaagaatcatcgaaacttttattgggctttcatgttctatttttgtggatcttcttttttggcccaaaagg |
41276178 |
T |
|
| Q |
111 |
gcttcaacatgtgccaaatatgaactatcccaatgtttgttcacactagttgaaacaattggaacattgagccttgttggcaaaactgattcacaattgg |
210 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41276177 |
gcttcaacatgtgccaaatatgaactctcccaatgtttgttcacactagttgaaacaattggaacattgagcctagttggcaaaactgattcacaattgg |
41276078 |
T |
|
| Q |
211 |
aagaaaatcaaagaaaacttaaggcccaagttaatgagcttagaaaatttgtggtagaggcagaagctgaacctaatttttggtttttaccatttcatag |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41276077 |
aagaaaatcaaagaaaacttaaggcccaagttaatgagcttagaaaatttgtggtagaggcagaagctgaacctaatttttggtttttaccatttcatag |
41275978 |
T |
|
| Q |
311 |
tggttgctataataggcttttaggctcattatcaaagttagtggatgtttt |
361 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
41275977 |
tggttgctataataggcttttaggctcattatcgaagttagtggatgtttt |
41275927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University