View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1965_low_20 (Length: 277)
Name: NF1965_low_20
Description: NF1965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1965_low_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 263
Target Start/End: Complemental strand, 44877602 - 44877340
Alignment:
| Q |
1 |
agtcaaatcgttctcaaaacggttttcttgattctggtgtagtcactcttgagaaagctcgtgatgctgttcctcatctcaatggttcaactaactacgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
44877602 |
agtcaaatcgttctcaaaacggttttcttgattctggtgtagtcactcttgagaaagctcgtgatgctgttcctcatctcaatgattcaactaactacgt |
44877503 |
T |
|
| Q |
101 |
tgatgataacggtgtgtatgtctatcaagatcgacccgttccgttttcttttggtactaaacgtgtttttgaagctgctgttgagtattcaagatctttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44877502 |
tgatgataacggtgtgtatgtctatcaagatcgacccgttccgttttcttttggtactaaacgtgtttttgaagctgctgttgagtattcaagatctttg |
44877403 |
T |
|
| Q |
201 |
aatcataattttgttgatcctgaacatattttcgttgctttgatgaaagttgatgatggaagt |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44877402 |
aatcataattttgttgatcctgaacatattttcgttgctttgatgaaagttgatgatggaagt |
44877340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University