View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1965_low_22 (Length: 243)
Name: NF1965_low_22
Description: NF1965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1965_low_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 18 - 221
Target Start/End: Complemental strand, 49762558 - 49762355
Alignment:
| Q |
18 |
atgaaatgattagcctactctgtacatgacttcaattccataatcttgacgaggctggtcattatacttcaatgcttcaagctgatgatgaacagcatct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49762558 |
atgaaatgattagcctactctgtacatgacttcaattccataatcttgacgaggctggtcattatacttcaatgcttcaagctgatgatgaacagcatct |
49762459 |
T |
 |
| Q |
118 |
tctgcagtgaactatagcaagatttatttaacagaattaaactnnnnnnnnnnnnngggaaacatacttggcaaatcaaatagtgctcacatctaatttt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49762458 |
tctgcagtgaactatagcaagatttatttaacagaattaaactaaaaaataaaaaagggaaacatacttggcaaatcaaatagtgctcacatctaatttt |
49762359 |
T |
 |
| Q |
218 |
ggac |
221 |
Q |
| |
|
|||| |
|
|
| T |
49762358 |
ggac |
49762355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University