View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1965_low_27 (Length: 206)
Name: NF1965_low_27
Description: NF1965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1965_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 9e-63; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 18 - 179
Target Start/End: Complemental strand, 34686358 - 34686197
Alignment:
| Q |
18 |
ttttttatgatttatatttgtttgaatgtgtgaatttaggaaatcttacttgcattgaaatcctaaatttacattctcaagcaaatatggtccgaacatt |
117 |
Q |
| |
|
||||||||| ||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| || |||| |
|
|
| T |
34686358 |
ttttttatgggttatagttgcttgaatgtgtgaatttaggaaatcttacttgcattgaaatcctaaatttacattgtcgagcaaatatggtcagaccatt |
34686259 |
T |
 |
| Q |
118 |
agaaaagatcaaatagtcgatgttagatttaggctttttaattcttttaaagttaagattag |
179 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34686258 |
agaaaagatcaaatagttgatgttagatttaggctttttaattcttttaaagctaagattag |
34686197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 82; E-Value: 6e-39
Query Start/End: Original strand, 45 - 178
Target Start/End: Complemental strand, 34694209 - 34694076
Alignment:
| Q |
45 |
gtgtgaatttaggaaatcttacttgcattgaaatcctaaatttacattctcaagcaaatatggtccgaacattagaaaagatcaaatagtcgatgttaga |
144 |
Q |
| |
|
|||||||||||||||| || |||||||| |||||||||||||||||| |||||||||||||||| || |||| |||||||||||||||| ||||||||| |
|
|
| T |
34694209 |
gtgtgaatttaggaaacattccttgcattcaaatcctaaatttacattgtcaagcaaatatggtcagaccattggaaaagatcaaatagttgatgttaga |
34694110 |
T |
 |
| Q |
145 |
tttaggctttttaattcttttaaagttaagatta |
178 |
Q |
| |
|
||||||||||| ||| |||||||| |||||||| |
|
|
| T |
34694109 |
tttaggcttttacatttttttaaagctaagatta |
34694076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University