View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19662_high_7 (Length: 253)
Name: NF19662_high_7
Description: NF19662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19662_high_7 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 13 - 253
Target Start/End: Complemental strand, 6002952 - 6002709
Alignment:
| Q |
13 |
attctgttattttgcagtcgcaaggtatttgaatccatcttgtccttttggaagctactagtagtagc---ttttatggataatatactagaatctgagt |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
6002952 |
attctgttattttgcagtcgcaaggtatttgaatccatcttgtccttttggaagctactagtagtagtagattttatggatattatactagaatctgagt |
6002853 |
T |
 |
| Q |
110 |
ggatcttgatctgcaagaattccttcttgttgaacgagatggctatgcttttaataaggatatacaatatgaaagactcac-nnnnnnnncctgtgtcaa |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | |
|
|
| T |
6002852 |
ggatcttgatctgcaagaattccttcttgttgaacgagatggctatgcttttaataaggatatacaatatgaaagactcactttttttttcctgtgtc-a |
6002754 |
T |
 |
| Q |
209 |
tgctattggttactcaagggatacttgttgtgcacgaaagaatac |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6002753 |
tgctattggttactcaagggatacttgttgtgcacgaaagaatac |
6002709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University