View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19664_high_12 (Length: 283)
Name: NF19664_high_12
Description: NF19664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19664_high_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 48 - 260
Target Start/End: Original strand, 31983138 - 31983350
Alignment:
| Q |
48 |
cacagaacaatttatgcaactcttttccaccatttgtttttagcctcatnnnnnnngataacgtagacagaacctgcttgtgaataatagcttaaactac |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31983138 |
cacagaacaatttatgcaactcttttccaccatttgtttttagcctcataaaaaaagataacgtagacagaacctgcttgtgaataatagcttaaactac |
31983237 |
T |
|
| Q |
148 |
aaaacgacataataatttattgtcctatgtttctgtcttatacaccaaatcaaaatgtctatgcttagatgcaaacatatgaaacaaaatatcaaagcgt |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31983238 |
aaaacgacataataatttattgtcctatgtttctgtcttatacaccaaatcaaaatgtctatgcttagatgcaaacatatgaaacaaaatatcaaagcgt |
31983337 |
T |
|
| Q |
248 |
gattagggcatga |
260 |
Q |
| |
|
||||||||||||| |
|
|
| T |
31983338 |
gattagggcatga |
31983350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University