View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19664_low_10 (Length: 360)
Name: NF19664_low_10
Description: NF19664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19664_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 18 - 348
Target Start/End: Original strand, 51836957 - 51837281
Alignment:
| Q |
18 |
ctttgttcatatttaaacctacgacctcaaactcatattcttttagttcaaatcagttgaac--------tatctaatccctaacaagaaaatatattta |
109 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
51836957 |
ctttgttcagatttaaacctacgacctcaaactcatattcttttagttcaaatcagttgaacacttgaactatctaacccctaacaagaaa--------- |
51837047 |
T |
|
| Q |
110 |
caacaaacagggagataatgataccattgtggttgcatatgagagagttaaggagtagagcacaggcaaaaaggagtgttgtatgattgaattggcaagc |
209 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51837048 |
-------cagggaaataatgataccattgtggttgcatatgagagagttaaggagtagagcacaggcaaaaaggagtgttgtatgattgaattggcaagc |
51837140 |
T |
|
| Q |
210 |
ga-aaaaatttt-tgagctaaatcagcagttgtgagcatcagtatcccacaatagacccaagcagcattcaaacgatttctttccccttttcattttctt |
307 |
Q |
| |
|
|| ||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51837141 |
gacaaaaattttatgagcgaaatcagcagttgtgagcatcagtatcccacaatagacccaagcagcattcaaacgatttctttccccttttcattttctt |
51837240 |
T |
|
| Q |
308 |
acaaacaaacatttgctagattttgtttgtattgatgatgt |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51837241 |
acaaacaaacatttgctagattttgtttgtattgatgatgt |
51837281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University