View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19666_high_11 (Length: 249)
Name: NF19666_high_11
Description: NF19666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19666_high_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 1162802 - 1163037
Alignment:
| Q |
1 |
cagcaataaccttcttaccagcttccaaaagcttcttagtcaaattcccagtaccaggaccaatttcaagaacaacatcagtagttttaataccagattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1162802 |
cagcaataaccttcttaccagcttccaaaagcttcttagtcaaattcccagtaccaggaccaatttcaagaacaacatcagtagttttaataccagattt |
1162901 |
T |
|
| Q |
101 |
ctgcacgatagtatcaacaagtaatggatttttgagaatatgttgaccttttgatttgtgaaaggaaattccaccttgatatggtgtgtgttgtgaagaa |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1162902 |
ctgcacaatagtatcaacaagtaatggatttttgagaatatgttgaccttttgatttgtgaaaggaaattccaccttgatatggtgtgtgttgtgaagaa |
1163001 |
T |
|
| Q |
201 |
ggttttcccttttccttccttatcttccctcctgcc |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
1163002 |
ggttttcccttttccttccttatcttccctcctgcc |
1163037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University