View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19666_high_14 (Length: 239)
Name: NF19666_high_14
Description: NF19666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19666_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 24 - 221
Target Start/End: Complemental strand, 1162680 - 1162480
Alignment:
| Q |
24 |
gttgggtatgttgtttggtttttgttaaatgttaaaaatttgacacatttataagatttatcaagatgtgttagctcctatggagcactgataccgacac |
123 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
1162680 |
gttgggtatgttgtttggtttttgttgaatgttaaaaatttgacacatttataagatatatcgagttgtgttagctcctatggagcactgataccgacac |
1162581 |
T |
 |
| Q |
124 |
tgac----acatatatattgggttgtgtttgtgtgttgcttagtgggggtatgtgtattggggcttctgttgcgnnnnnnngtgctgcagtttttctttg |
219 |
Q |
| |
|
||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
1162580 |
-gacactgacacatatattgggttgtgtttgtgtgttgcttagtgggggtatgtgtattggggcttctgttacgtttttttgtgctgcagtttttctttg |
1162482 |
T |
 |
| Q |
220 |
ta |
221 |
Q |
| |
|
|| |
|
|
| T |
1162481 |
ta |
1162480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University