View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19666_high_8 (Length: 266)
Name: NF19666_high_8
Description: NF19666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19666_high_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 4e-81; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 1 - 153
Target Start/End: Original strand, 44884919 - 44885071
Alignment:
| Q |
1 |
aaacctctttatgacggggaacagcccccttttgtggcaaatatatgtcgatttggcaacacaaatcaaattaaattattgtgcaaaatattcattgaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44884919 |
aaacctctttatgacggggaacagcccccttttgtggcaaatatatgtcgatttggcaacacaaatcaaattaaattattgtgcaaaatattcattgaat |
44885018 |
T |
|
| Q |
101 |
gtggccaaatgacacaaatctggacataaacgaaatcttataaaaattacaca |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44885019 |
gtggccaaatgacacaaatctggacataaacgaaatcttataaaaattacaca |
44885071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 44885128 - 44885230
Alignment:
| Q |
151 |
acatgaacccttcctgagcctaagccctagtatgctttaagccctataatgttggtcttccttgctccacttggccactgccattatccccaagattatg |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44885128 |
acatgaacccttcctgagcctaagccctagtatgctttaagccctataatgttggttttccttgctccacttggccactgccattatccccaagattatg |
44885227 |
T |
|
| Q |
251 |
tct |
253 |
Q |
| |
|
||| |
|
|
| T |
44885228 |
tct |
44885230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University