View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19666_low_1 (Length: 583)
Name: NF19666_low_1
Description: NF19666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19666_low_1 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 5e-85; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 5e-85
Query Start/End: Original strand, 322 - 583
Target Start/End: Original strand, 25493143 - 25493395
Alignment:
| Q |
322 |
tggttttaattgcatgcttttcagtttttgctagggtaatttatttgtaaatgtgtgagaggggtgagaaaaggtttaactttttctgtttcgcatgtat |
421 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
25493143 |
tggttttaattgcatgcttttcagtttttgctagggtaagttatttgtatatgtgtgagaggggtgagaaaaggtttaccttttg-------gcatgtat |
25493235 |
T |
|
| Q |
422 |
gctttcaccatgaagttacttcatcaacaaagctatactgacgtgatgctcacgcatgactcggnnnnnnnngttaggtggccctctctttcccagagcc |
521 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |||| |||||||||||||||||| | ||||||||||||||||||| |||||||| |
|
|
| T |
25493236 |
gctttcaccatgaagttacttcatcagcaaagctatattgacttgatgctcacgcatgacttg--tatttttgttaggtggccctctcttttccagagcc |
25493333 |
T |
|
| Q |
522 |
tctcattcattttgctttagtatgtggtactcgatctgggcctgcacttcggtgttattctc |
583 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
25493334 |
tctcattcactttgctttagtatgtggtactcgatctgggcctgcacttcgatgttattctc |
25493395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 20 - 115
Target Start/End: Original strand, 25493033 - 25493119
Alignment:
| Q |
20 |
tgactctcacatcaatctattatacatttttccccgaattatgtcgctgtatttggtgcattcaaatggaaaatttggttcaatgatagagttgct |
115 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||| ||||||| |||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
25493033 |
tgactctcacatcaatctattatacatttcttcccaaattatggcgctgt---------attcaaattgaaaatttggttcaatgatagagttgct |
25493119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 496 - 583
Target Start/End: Original strand, 33184435 - 33184522
Alignment:
| Q |
496 |
taggtggccctctctttcccagagcctctcattcattttgctttagtatgtggtactcgatctgggcctgcacttcggtgttattctc |
583 |
Q |
| |
|
||||| || ||| ||| ||| |||||| | |||||||||||||| |||||||| || |||||||||||||| ||||| || ||||||| |
|
|
| T |
33184435 |
taggttgcactcccttaccccgagcctatgattcattttgctttggtatgtggcacccgatctgggcctgcccttcgatgctattctc |
33184522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 164 - 217
Target Start/End: Complemental strand, 39615819 - 39615766
Alignment:
| Q |
164 |
attagttcttatttgctctgcttcctttattccttctatgataaactattacat |
217 |
Q |
| |
|
||||||||||| | ||| |||||||||||||| | ||||||||||||||||||| |
|
|
| T |
39615819 |
attagttcttactggctgtgcttcctttattcatcctatgataaactattacat |
39615766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University