View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19666_low_21 (Length: 206)
Name: NF19666_low_21
Description: NF19666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19666_low_21 |
 |  |
|
| [»] scaffold0187 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0187 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: scaffold0187
Description:
Target: scaffold0187; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 41 - 188
Target Start/End: Original strand, 2388 - 2535
Alignment:
| Q |
41 |
atttcattatgtgcattactttattacataagatttgggtagaaaactagacccttgtaagttcaaatataaatttcagtttcatgattaagtagtaaat |
140 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2388 |
atttcattatgtgcattactttattgcataagatttcggtagaaaactagacccttgtaagttcaaatataaatttcagtttcatgattaagtagtaaat |
2487 |
T |
 |
| Q |
141 |
attttgggcacctatatgacatgcttataagacggcccctgtacattc |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2488 |
attttgggcacctatatgacatgcttataagacggcacctgtacattc |
2535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University