View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19666_low_22 (Length: 204)
Name: NF19666_low_22
Description: NF19666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19666_low_22 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 11 - 189
Target Start/End: Complemental strand, 38691536 - 38691358
Alignment:
| Q |
11 |
ataatacttgtcattgaatattagatggtacaattttaacattaaattgacccttcatgttacacttaacaggtttgggggttaaagacaaagcaagtca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38691536 |
ataatacttgtcattgaatattagatggtacaattttaacattaaattgacccttcatgttacacttaacaggtttaggggttaaagacaaagcaagtca |
38691437 |
T |
|
| Q |
111 |
tatgttgtctttaaatgggattgatatatacaataagatctcatggatgcaaatgttgttaatatactaaccgaaaaat |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38691436 |
tatgttgtctttaaatgggattgatatatacaataagatctcatgtatgcaaatgttgttaatatactaaccgaaaaat |
38691358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University