View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19667_low_4 (Length: 221)
Name: NF19667_low_4
Description: NF19667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19667_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 85 - 173
Target Start/End: Original strand, 34968561 - 34968649
Alignment:
| Q |
85 |
tttttatttattaatgtgggtgtagtttaaaaaattcagaatgtgtgttttaaattctggtgtgattgcgatcgctaataagacataaa |
173 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34968561 |
tttttttttattaatgtgggtgtagtttaaaaaattcagaatgtgtgttttaaattctggtgtgattgcgatcgctaataagacataaa |
34968649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 18 - 97
Target Start/End: Complemental strand, 34965487 - 34965408
Alignment:
| Q |
18 |
agggctaaaaaatatttcattgaggttaacaacgcatgcaattgcttctataaagttatcaaacaaatttttatttatta |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34965487 |
agggctaaaaaatatttcattgaggttaacaacgcatgcaattgcttctataaagttatcaaacaaatttttatttatta |
34965408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University