View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19667_low_5 (Length: 212)

Name: NF19667_low_5
Description: NF19667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19667_low_5
NF19667_low_5
[»] chr5 (1 HSPs)
chr5 (19-196)||(28298590-28298770)


Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 19 - 196
Target Start/End: Complemental strand, 28298770 - 28298590
Alignment:
19 gaggtgggtgagttggcagcggtgatagcaaggatatgtgagacaagttcggtaataggaacataaaggaacttaaatatgaaagagtccaaactgaaaa 118  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||| |||||||||||||||    
28298770 gaggtgggcgagttggcagcggtgatagcaaggatatgtgagacaagtttggtaacaggaacataaaggaacttaaatatgaaacagtccaaactgaaaa 28298671  T
119 tgaaaatatgaaggatatatatgagatgcaaattaaagtaagctggtacctatgaagaaata---aaggagtcgaattgtg 196  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||   ||||||||||||||||    
28298670 tgaaaatatgaaggatatatatgagatgcaaatgaaagtaagctggtacctatgaagaaataaagaaggagtcgaattgtg 28298590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University