View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19668_high_1 (Length: 214)

Name: NF19668_high_1
Description: NF19668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19668_high_1
NF19668_high_1
[»] chr3 (1 HSPs)
chr3 (96-178)||(26854889-26854971)


Alignment Details
Target: chr3 (Bit Score: 79; Significance: 4e-37; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 96 - 178
Target Start/End: Original strand, 26854889 - 26854971
Alignment:
96 cctcacaaataaagaaaaaatggttaaccattagaatgaaatgggaacactagatctcccactttgacgtatatccacaatct 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
26854889 cctcacaaataaagaaaaaatggttaaccattagaatgaaatgggaacactagatctcccagtttgacgtatatccacaatct 26854971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University