View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19668_high_7 (Length: 312)
Name: NF19668_high_7
Description: NF19668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19668_high_7 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 6 - 312
Target Start/End: Complemental strand, 52580608 - 52580302
Alignment:
| Q |
6 |
agtagcataggcgaagaaaagatggccgttaatgttactagctttcatatcaatttcaacagtgatgattcttttcatgagacctaacaattccgattca |
105 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52580608 |
agtagcattggcgaagaaaagatggccgttaatgttactagctttcatatcaatttcaacagtgatgattcttttcatgagacctaacaattccgattca |
52580509 |
T |
 |
| Q |
106 |
tgcaacacaacaaagaccttcgaagcacaacagagtcagattcatccctcctccgtcggaaatgcaccatctggtccaagccccttggatttcatgaaat |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
52580508 |
tgcaacacaacaaagaccttcgaagcacaacagagtcagattcatccctcctccgtcggaaatgcaccagctggtccaagccccttggatttcatgaaat |
52580409 |
T |
 |
| Q |
206 |
cgaagcttgttctcatggtttcgcatgaactatctctttctggtggacctttacttttgatggaattggcgtttttgttgagaggtgttggttctgatgt |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52580408 |
cgaagcttgttctcatggtttcgcatgaactatctctttctggtggacctttacttttgatggaattggcgtttttgttgagaggtgttggttctgatgt |
52580309 |
T |
 |
| Q |
306 |
tgtttgg |
312 |
Q |
| |
|
||||||| |
|
|
| T |
52580308 |
tgtttgg |
52580302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University