View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1966_high_18 (Length: 227)
Name: NF1966_high_18
Description: NF1966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1966_high_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 5e-52; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 5 - 124
Target Start/End: Original strand, 12568311 - 12568430
Alignment:
| Q |
5 |
cataatgtatcattatgtttattttacgggtttcctaactaacaagacaaatgtccacaaattattgattaataacaaaaatgaaagaaacattctccct |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
12568311 |
cataatgtatcattatgtttattttacgggtttcctaactaaccagacaaatgtccacaaattattgattgattacaaaaatgaaagaaacattctccct |
12568410 |
T |
|
| Q |
105 |
ccacgtcaaattaaagtcat |
124 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
12568411 |
gcacgtcaaattaaagtcat |
12568430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 126 - 227
Target Start/End: Original strand, 12568579 - 12568680
Alignment:
| Q |
126 |
tagtaatgttttctcacaaagtgtcaatttataatttaaaattttgataattaannnnnnnnaataaatactcattatttatagaatctttaatatattc |
225 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12568579 |
tagtcatgttttctcacaaagtgtcaatttatattttaaaattttaataattaattttttttaataaatactcattatttatagaatctttaatatattc |
12568678 |
T |
|
| Q |
226 |
tt |
227 |
Q |
| |
|
|| |
|
|
| T |
12568679 |
tt |
12568680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University