View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1966_high_19 (Length: 221)
Name: NF1966_high_19
Description: NF1966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1966_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 13 - 198
Target Start/End: Original strand, 52546305 - 52546490
Alignment:
| Q |
13 |
agaatataactaagtgagaattgacagtaattgaaatggtaaatataccctttgaggagcatcatatgatttgtgagcatgacaagttccttctcgaaaa |
112 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52546305 |
agaaaataactaagtgagaattgacagtaattgaaatggtaaatataccctttgaggagcatcatatgatttgtgagcatgacaagttccttctcgaaag |
52546404 |
T |
 |
| Q |
113 |
tttccacaagtaccttgaggcaatccatagctagcaaatttaatttgggtgatcttttgtccaatgggacaccacaagtcagctag |
198 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
52546405 |
tttcgacaagtaccttgtggcaatccatagctagcaaatttaatttgggtgatcttttgtccaatgggacaccgcaagtcagctag |
52546490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University