View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1966_high_7 (Length: 348)
Name: NF1966_high_7
Description: NF1966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1966_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 95 - 341
Target Start/End: Original strand, 40409329 - 40409575
Alignment:
| Q |
95 |
cagtcacgaacgtgtggtaaattaaggacattggacatgggagaaagattgccacacttacattcccacaagaccgtttcaactggttcaggactccaat |
194 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
40409329 |
cagtcacgagcgtgtggtaaattaaggacattggacatgggagaaagattgccacacttacattcccaccagaccgtttcgactggttcaggactccaat |
40409428 |
T |
 |
| Q |
195 |
ttatggatccgattttttcccactacttaataatgggttttctaccgttagtaatgcgatgattactgcattttcagagaggtagcacgaggagaccagt |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
40409429 |
ttatggatccgattttttcccactacttaataatgggttttctgccgttagtaatgcgattattactgcattttcagagaggtagcacgaggagacgagt |
40409528 |
T |
 |
| Q |
295 |
aacttacatcagcatgttatggagatgatcatcacacttgatgatgt |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40409529 |
aacttacatcagcatgttatggagatgatcatcacacttgatgatgt |
40409575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University