View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1966_low_37 (Length: 201)
Name: NF1966_low_37
Description: NF1966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1966_low_37 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 7 - 186
Target Start/End: Complemental strand, 55334841 - 55334665
Alignment:
| Q |
7 |
tgagatgaatactacggttaaaaatatttatagttttgtcgtgatactgagtgagtttccagtaaaaatataataataatannnnnnnacggtggccatg |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
55334841 |
tgagatgaatactacggttaaaaatatttatagttttgtcgtgatactgagtgagtttccagtaaaaatataataataatatttttttacggtggccatg |
55334742 |
T |
|
| Q |
107 |
tccaaaatccttttagctaggatgtcctccattgttataa-atttatcttcttttcgttatatatatgtgatataataagt |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
55334741 |
tccaaaatccttttagctaggatgtcctccattgttataacgtttatcttcttttcgt----tatatgtgatataataagt |
55334665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University