View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1966_low_5 (Length: 502)
Name: NF1966_low_5
Description: NF1966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1966_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 230 - 445
Target Start/End: Original strand, 46686041 - 46686255
Alignment:
| Q |
230 |
gacattattgcgagttttgcgacaacaataaatattttcccaaaccacctagtgggactttctcccccatccaatttgtgtgggggaaaacatcccgcca |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
46686041 |
gacattattgcgagttttgcgacaacaataaatattttcccaaatcacctagtgggactttctcccccatccaattcgtgtgggggaaaacttcccgcca |
46686140 |
T |
|
| Q |
330 |
acgagaccccaaatggggccccccgctgttgggacggggagttttaaaaaactttgctaattgattacgttgaattaaaagcaatcataaaagtgaattt |
429 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
46686141 |
gcgagaccccaaatgggg-cccccgctgttgggacggggagttttaaaaaactttgctaattgattacgttgaattaaaagcaatcatacaagtgaattt |
46686239 |
T |
|
| Q |
430 |
aaaaagagaaatgata |
445 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
46686240 |
aaaaagagaaatgata |
46686255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 106; E-Value: 8e-53
Query Start/End: Original strand, 19 - 140
Target Start/End: Original strand, 46685830 - 46685951
Alignment:
| Q |
19 |
agtagggatgtcaatgagacgggtgttggcgggagtactcccaccatccaacatgctcatcaactccattccccgccttggggagtattctcctcctaaa |
118 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46685830 |
agtagggatgtcaatgagacgggtgctggcgggagtactcccgccatccaaaatgctcatcaactccattccccgccttggggagtattctcctcctaaa |
46685929 |
T |
|
| Q |
119 |
tctctgtctccgccccatgatc |
140 |
Q |
| |
|
|||| ||||||||||||||||| |
|
|
| T |
46685930 |
tctccgtctccgccccatgatc |
46685951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University