View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19670_high_10 (Length: 288)
Name: NF19670_high_10
Description: NF19670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19670_high_10 |
 |  |
|
| [»] chr8 (9 HSPs) |
 |  |
|
| [»] chr7 (5 HSPs) |
 |  |
|
| [»] chr6 (6 HSPs) |
 |  |
|
| [»] chr4 (7 HSPs) |
 |  |
|
| [»] chr2 (4 HSPs) |
 |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 241; Significance: 1e-133; HSPs: 9)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 288
Target Start/End: Complemental strand, 37126356 - 37126067
Alignment:
| Q |
1 |
ctgaactggtgggacttgatgtggtttggtatcggtgcggtcgtcggctccggaatattcgtgctgaccggacttgaggctaagcagcatgcaggtccgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37126356 |
ctgaactggtgggacttgatgtggtttggtatcggtgcggtcgtcggctccggaatatttgtgctgaccggacttgaggctaagcagcatgcaggtccgg |
37126257 |
T |
 |
| Q |
101 |
cagttgtgttgtcatttgtcatctccggcatatctgctttgttatcagtgttttgctatacagagtttgcggtggaaattccggttgcaggtactttctc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37126256 |
cagttgtgttgtcatttgtcatctccggcatatctgctttgttatcagtattttgctatacagagtttgcggtggaaattccggttgcaggtactttctc |
37126157 |
T |
 |
| Q |
201 |
ttattctcactataatctttcttatgcattatatgatcatt---ggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattt |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| || ||||||||||||||||||||| |
|
|
| T |
37126156 |
ttattctcactataatctttcttatgcattatatgatcatttgcagcaaaaatatgattttggtc-ctgaaaatatgtctcgttttgattt |
37126067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 37113618 - 37113405
Alignment:
| Q |
1 |
ctgaactggtgggacttgatgtggtttggtatcggtgcggtcgtcggctccggaatattcgtgctgaccggacttgaggctaagcagcatgcaggtccgg |
100 |
Q |
| |
|
||||| |||||||||||||||||||| ||||| || || ||| | || || |||||||| ||||| |||||||||||||||| |||| | |||||||||| |
|
|
| T |
37113618 |
ctgaattggtgggacttgatgtggttcggtatgggcgccgtcattggttctggaatatttgtgcttaccggacttgaggctaggcaggaagcaggtccgg |
37113519 |
T |
 |
| Q |
101 |
cagttgtgttgtcatttgtcatctccggcatatctgctttgttatcagtgttttgctatacagagtttgcggtggaaattccggttgcaggtactttctc |
200 |
Q |
| |
|
||||||| ||||| |||||||||||||| |||||||||||| |||| |||||||| |||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37113518 |
cagttgtattgtcgtttgtcatctccggtatatctgctttgctatcggtgttttgttatacagaatttgctgtggaaattccggttgcaggtactttctc |
37113419 |
T |
 |
| Q |
201 |
ttattctcactata |
214 |
Q |
| |
|
||| ||||||||| |
|
|
| T |
37113418 |
ttaccctcactata |
37113405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 239 - 284
Target Start/End: Original strand, 1778561 - 1778606
Alignment:
| Q |
239 |
attggcaaaaatatagttttggtctttgcaaatatgtctcgttttg |
284 |
Q |
| |
|
|||||| ||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
1778561 |
attggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
1778606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 240 - 284
Target Start/End: Complemental strand, 7186006 - 7185962
Alignment:
| Q |
240 |
ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttg |
284 |
Q |
| |
|
||||| ||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
7186006 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
7185962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 240 - 284
Target Start/End: Complemental strand, 14489075 - 14489031
Alignment:
| Q |
240 |
ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttg |
284 |
Q |
| |
|
||||| ||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
14489075 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
14489031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 239 - 283
Target Start/End: Original strand, 23939544 - 23939588
Alignment:
| Q |
239 |
attggcaaaaatatagttttggtctttgcaaatatgtctcgtttt |
283 |
Q |
| |
|
|||||| ||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
23939544 |
attggctaaaatatggttttggtcactgcaaatatgtctcgtttt |
23939588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 240 - 284
Target Start/End: Complemental strand, 34963666 - 34963622
Alignment:
| Q |
240 |
ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttg |
284 |
Q |
| |
|
||||| ||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
34963666 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
34963622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 240 - 284
Target Start/End: Original strand, 42132862 - 42132906
Alignment:
| Q |
240 |
ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttg |
284 |
Q |
| |
|
||||| ||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
42132862 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
42132906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 240 - 284
Target Start/End: Complemental strand, 42133156 - 42133112
Alignment:
| Q |
240 |
ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttg |
284 |
Q |
| |
|
||||| ||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
42133156 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
42133112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.0000000001; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 246 - 288
Target Start/End: Complemental strand, 39520726 - 39520684
Alignment:
| Q |
246 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattt |
288 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39520726 |
aaaatatggttttggtccttgcaaatatgtctcgttttgattt |
39520684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 246 - 288
Target Start/End: Original strand, 19005602 - 19005644
Alignment:
| Q |
246 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattt |
288 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
19005602 |
aaaatatagttttggtccctgtaaatatgtctcgttttgattt |
19005644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 246 - 284
Target Start/End: Complemental strand, 28529205 - 28529167
Alignment:
| Q |
246 |
aaaatatagttttggtctttgcaaatatgtctcgttttg |
284 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
28529205 |
aaaatatggttttggtctctgcaaatatgtctcgttttg |
28529167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 240 - 288
Target Start/End: Complemental strand, 25547492 - 25547444
Alignment:
| Q |
240 |
ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattt |
288 |
Q |
| |
|
||||| ||||||| ||||| ||| |||||||||||||||||||||||| |
|
|
| T |
25547492 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttgattt |
25547444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 240 - 284
Target Start/End: Complemental strand, 44403251 - 44403207
Alignment:
| Q |
240 |
ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttg |
284 |
Q |
| |
|
||||| ||||||| ||||| ||| ||||||||||||||||||||| |
|
|
| T |
44403251 |
ttggctaaaatatggttttagtccttgcaaatatgtctcgttttg |
44403207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.0000000001; HSPs: 6)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 246 - 288
Target Start/End: Original strand, 15722614 - 15722656
Alignment:
| Q |
246 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattt |
288 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
15722614 |
aaaatatggttttggtctatgcaaatatgtctcgttttgattt |
15722656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 246 - 284
Target Start/End: Complemental strand, 14656256 - 14656218
Alignment:
| Q |
246 |
aaaatatagttttggtctttgcaaatatgtctcgttttg |
284 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
14656256 |
aaaatatggttttggtccttgcaaatatgtctcgttttg |
14656218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 246 - 284
Target Start/End: Original strand, 18024015 - 18024053
Alignment:
| Q |
246 |
aaaatatagttttggtctttgcaaatatgtctcgttttg |
284 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
18024015 |
aaaatatggttttggtctttgcaaatatgcctcgttttg |
18024053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 246 - 288
Target Start/End: Complemental strand, 31276336 - 31276294
Alignment:
| Q |
246 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattt |
288 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
31276336 |
aaaataaagttttggtccctgcaaatatgtctcgttttgattt |
31276294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 239 - 284
Target Start/End: Complemental strand, 19690762 - 19690717
Alignment:
| Q |
239 |
attggcaaaaatatagttttggtctttgcaaatatgtctcgttttg |
284 |
Q |
| |
|
|||||| ||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
19690762 |
attggcgaaaatatggttttggtccctgcaaatatgtctcgttttg |
19690717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 240 - 284
Target Start/End: Original strand, 24901237 - 24901281
Alignment:
| Q |
240 |
ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttg |
284 |
Q |
| |
|
||||| ||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
24901237 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
24901281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.0000000001; HSPs: 6)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 246 - 284
Target Start/End: Original strand, 4736209 - 4736247
Alignment:
| Q |
246 |
aaaatatagttttggtctttgcaaatatgtctcgttttg |
284 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4736209 |
aaaatatggttttggtctttgcaaatatgtctcgttttg |
4736247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 246 - 288
Target Start/End: Complemental strand, 12145179 - 12145137
Alignment:
| Q |
246 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattt |
288 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
12145179 |
aaaatatggttttggtccctgcaaatatgtctcgttttgattt |
12145137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 246 - 288
Target Start/End: Complemental strand, 37271702 - 37271660
Alignment:
| Q |
246 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattt |
288 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
37271702 |
aaaatatggttttggtccctgcaaatatgtctcgttttgattt |
37271660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 246 - 288
Target Start/End: Complemental strand, 38452392 - 38452350
Alignment:
| Q |
246 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattt |
288 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
38452392 |
aaaatatggttttggtccctgcaaatatgtctcgttttgattt |
38452350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 239 - 284
Target Start/End: Complemental strand, 35928461 - 35928416
Alignment:
| Q |
239 |
attggcaaaaatatagttttggtctttgcaaatatgtctcgttttg |
284 |
Q |
| |
|
|||||| ||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
35928461 |
attggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
35928416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 239 - 284
Target Start/End: Original strand, 36973350 - 36973395
Alignment:
| Q |
239 |
attggcaaaaatatagttttggtctttgcaaatatgtctcgttttg |
284 |
Q |
| |
|
|||||| ||||||| |||||||||| | |||||||||||||||||| |
|
|
| T |
36973350 |
attggctaaaatatggttttggtctctccaaatatgtctcgttttg |
36973395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 7)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 246 - 288
Target Start/End: Complemental strand, 28449210 - 28449168
Alignment:
| Q |
246 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattt |
288 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28449210 |
aaaatatggttttggtccttgcaaatatgtctcgttttgattt |
28449168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 246 - 288
Target Start/End: Complemental strand, 11693117 - 11693075
Alignment:
| Q |
246 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattt |
288 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
11693117 |
aaaatatggttttggtccctgcaaatatgtctcgttttgattt |
11693075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 246 - 284
Target Start/End: Original strand, 47022744 - 47022782
Alignment:
| Q |
246 |
aaaatatagttttggtctttgcaaatatgtctcgttttg |
284 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
47022744 |
aaaatatggttttggtccttgcaaatatgtctcgttttg |
47022782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 246 - 284
Target Start/End: Original strand, 52543426 - 52543464
Alignment:
| Q |
246 |
aaaatatagttttggtctttgcaaatatgtctcgttttg |
284 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
52543426 |
aaaatatggttttggtccttgcaaatatgtctcgttttg |
52543464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 247 - 284
Target Start/End: Complemental strand, 47532667 - 47532630
Alignment:
| Q |
247 |
aaatatagttttggtctttgcaaatatgtctcgttttg |
284 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
47532667 |
aaatatggttttggtccttgcaaatatgtctcgttttg |
47532630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 240 - 284
Target Start/End: Original strand, 13073757 - 13073801
Alignment:
| Q |
240 |
ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttg |
284 |
Q |
| |
|
||||| ||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
13073757 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
13073801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 240 - 288
Target Start/End: Complemental strand, 42824093 - 42824045
Alignment:
| Q |
240 |
ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattt |
288 |
Q |
| |
|
||||| ||||||| ||||||||| ||||||||||||| |||||||||| |
|
|
| T |
42824093 |
ttggctaaaatatggttttggtccctgcaaatatgtcttgttttgattt |
42824045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.0000000001; HSPs: 7)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 246 - 284
Target Start/End: Original strand, 29678028 - 29678066
Alignment:
| Q |
246 |
aaaatatagttttggtctttgcaaatatgtctcgttttg |
284 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29678028 |
aaaatatagttttggtctttgcaaatatgcctcgttttg |
29678066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 240 - 288
Target Start/End: Original strand, 20644503 - 20644551
Alignment:
| Q |
240 |
ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattt |
288 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
20644503 |
ttggctaaaatatagttttggtccctgcaaatatgtctcattttgattt |
20644551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 246 - 284
Target Start/End: Complemental strand, 19297945 - 19297907
Alignment:
| Q |
246 |
aaaatatagttttggtctttgcaaatatgtctcgttttg |
284 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
19297945 |
aaaatatagttttggtccttgtaaatatgtctcgttttg |
19297907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 246 - 284
Target Start/End: Complemental strand, 40279331 - 40279293
Alignment:
| Q |
246 |
aaaatatagttttggtctttgcaaatatgtctcgttttg |
284 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
40279331 |
aaaatatggttttggtctttgcaaatatgtcttgttttg |
40279293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 246 - 283
Target Start/End: Original strand, 32119224 - 32119261
Alignment:
| Q |
246 |
aaaatatagttttggtctttgcaaatatgtctcgtttt |
283 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32119224 |
aaaatatagttttggtccctgcaaatatgtctcgtttt |
32119261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 240 - 288
Target Start/End: Complemental strand, 40169656 - 40169608
Alignment:
| Q |
240 |
ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattt |
288 |
Q |
| |
|
||||| ||||||| ||||| ||| |||||||||||||||||||||||| |
|
|
| T |
40169656 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttgattt |
40169608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 240 - 284
Target Start/End: Original strand, 43441268 - 43441312
Alignment:
| Q |
240 |
ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttg |
284 |
Q |
| |
|
||||| ||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
43441268 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
43441312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 246 - 288
Target Start/End: Original strand, 45442320 - 45442362
Alignment:
| Q |
246 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattt |
288 |
Q |
| |
|
||||||| ||||| |||| |||||||||||||||||||||||| |
|
|
| T |
45442320 |
aaaatatggttttagtctctgcaaatatgtctcgttttgattt |
45442362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 239 - 284
Target Start/End: Original strand, 42695865 - 42695910
Alignment:
| Q |
239 |
attggcaaaaatatagttttggtctttgcaaatatgtctcgttttg |
284 |
Q |
| |
|
|||||| ||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
42695865 |
attggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
42695910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 240 - 288
Target Start/End: Original strand, 1497608 - 1497656
Alignment:
| Q |
240 |
ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattt |
288 |
Q |
| |
|
||||| ||||||| ||||| ||| ||||||||||| ||||||||||||| |
|
|
| T |
1497608 |
ttggctaaaatatggttttagtccttgcaaatatgcctcgttttgattt |
1497656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 239 - 283
Target Start/End: Complemental strand, 34964162 - 34964118
Alignment:
| Q |
239 |
attggcaaaaatatagttttggtctttgcaaatatgtctcgtttt |
283 |
Q |
| |
|
|||||| ||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
34964162 |
attggctaaaatatggttttggtccctgcaaatatgtctcgtttt |
34964118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 9)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 246 - 284
Target Start/End: Original strand, 26207282 - 26207320
Alignment:
| Q |
246 |
aaaatatagttttggtctttgcaaatatgtctcgttttg |
284 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
26207282 |
aaaatatggttttggtccttgcaaatatgtctcgttttg |
26207320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 246 - 284
Target Start/End: Original strand, 32420102 - 32420140
Alignment:
| Q |
246 |
aaaatatagttttggtctttgcaaatatgtctcgttttg |
284 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
32420102 |
aaaatatggttttggtccttgcaaatatgtctcgttttg |
32420140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 246 - 288
Target Start/End: Complemental strand, 32906236 - 32906194
Alignment:
| Q |
246 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattt |
288 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
32906236 |
aaaatatgattttggtccttgcaaatatgtctcgttttgattt |
32906194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 246 - 288
Target Start/End: Original strand, 39025113 - 39025155
Alignment:
| Q |
246 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattt |
288 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
39025113 |
aaaatatggttttggtccctgcaaatatgtctcgttttgattt |
39025155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 246 - 284
Target Start/End: Original strand, 49073695 - 49073733
Alignment:
| Q |
246 |
aaaatatagttttggtctttgcaaatatgtctcgttttg |
284 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
49073695 |
aaaatatggttttggtccttgcaaatatgtctcgttttg |
49073733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 239 - 284
Target Start/End: Original strand, 10631161 - 10631206
Alignment:
| Q |
239 |
attggcaaaaatatagttttggtctttgcaaatatgtctcgttttg |
284 |
Q |
| |
|
|||||| ||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
10631161 |
attggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
10631206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 239 - 284
Target Start/End: Complemental strand, 12322973 - 12322928
Alignment:
| Q |
239 |
attggcaaaaatatagttttggtctttgcaaatatgtctcgttttg |
284 |
Q |
| |
|
|||||| ||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
12322973 |
attggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
12322928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 239 - 284
Target Start/End: Original strand, 24977775 - 24977820
Alignment:
| Q |
239 |
attggcaaaaatatagttttggtctttgcaaatatgtctcgttttg |
284 |
Q |
| |
|
|||||| ||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
24977775 |
attggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
24977820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 240 - 284
Target Start/End: Original strand, 40718108 - 40718152
Alignment:
| Q |
240 |
ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttg |
284 |
Q |
| |
|
||||| ||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
40718108 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
40718152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 241 - 285
Target Start/End: Complemental strand, 2884 - 2840
Alignment:
| Q |
241 |
tggcaaaaatatagttttggtctttgcaaatatgtctcgttttga |
285 |
Q |
| |
|
|||| ||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
2884 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttga |
2840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University