View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19670_low_17 (Length: 236)
Name: NF19670_low_17
Description: NF19670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19670_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 16 - 219
Target Start/End: Original strand, 47627752 - 47627956
Alignment:
| Q |
16 |
tattagtggaaaaaagaattcatgttcatttgaatcacgtcgtatcgatgatctcttaagtcacgtgagtatccaaatcctatttgtttttctctgtatt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
47627752 |
tattagtggaaaaaagaattcatgttcatttgaatcacgtcgtatcgatgatctcttaagtcacgtgagtatccaaaccctatttgtttttctctgtatt |
47627851 |
T |
 |
| Q |
116 |
ttattgttagttccttatatagatccc-aaaaatgcaaattaataaggaaaataatcaggaaatgaaatgtattatatttatggtttcaggcttggaatc |
214 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
47627852 |
ttattgttagttccttatatagatcccaaaaaatgcaaattaataaggaaaataatcaggaaatgaaatgtattatatttatggcttcaggcttggaatc |
47627951 |
T |
 |
| Q |
215 |
aatgg |
219 |
Q |
| |
|
||||| |
|
|
| T |
47627952 |
aatgg |
47627956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University