View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19672_low_3 (Length: 210)
Name: NF19672_low_3
Description: NF19672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19672_low_3 |
 |  |
|
| [»] scaffold0024 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0024 (Bit Score: 106; Significance: 3e-53; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 18 - 135
Target Start/End: Original strand, 124960 - 125077
Alignment:
| Q |
18 |
cttatgcatccaacttccctcctctttaatataggataaatatcttaacaaattagacatatggttttattggtataaatatatcaacaaactgcatata |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
124960 |
cttatgcatccaacttccctcctctttaatataggataaatatcttaacaaattagacatatagttttattggtataaatatgtcaacaaattgcatata |
125059 |
T |
 |
| Q |
118 |
taattttgatcttatcta |
135 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
125060 |
taattttgatcttatcta |
125077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 133 - 179
Target Start/End: Original strand, 125228 - 125275
Alignment:
| Q |
133 |
ctagttaagtcttcaataaaagggtt-acttgacgaaatgtaaatatc |
179 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
125228 |
ctagttaagtcttcaataaaagggttaacttgacgaaatgtaaatatc |
125275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 85 - 133
Target Start/End: Complemental strand, 37438060 - 37438012
Alignment:
| Q |
85 |
tattggtataaatatatcaacaaactgcatatataattttgatcttatc |
133 |
Q |
| |
|
|||||| ||||||||||||||||||| ||| ||| |||||||||||||| |
|
|
| T |
37438060 |
tattggcataaatatatcaacaaacttcatttattattttgatcttatc |
37438012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University