View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19673_low_12 (Length: 346)
Name: NF19673_low_12
Description: NF19673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19673_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 17 - 335
Target Start/End: Original strand, 2810913 - 2811231
Alignment:
| Q |
17 |
actatttgagttgtttatttcaaatattttgttataatttggtaattgactagaatggttggatgatatttgcagggtggattgttcttggggccatcag |
116 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2810913 |
actatttgacttgtttatttcaaatattttgttataatttggtaattgactagaatggttggatgatatttgcagggtggattgttcttggggccatcag |
2811012 |
T |
 |
| Q |
117 |
tgcttggtagacatgaaaattttgcaaatattgtatttccactaaaaagtgcaatggttttagaaacaatggcaaacataggtctgatatactttctgtt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2811013 |
tgcttggtagacatgaaaattttgcaaatattgtatttccactaaaaagtgcaatggttttagaaacaatggcaaacataggtctgatatactttctgtt |
2811112 |
T |
 |
| Q |
217 |
cctaattggtttagagatggacatatctattgtgaaacgcaccggtgcaaaggcggtgtccattgcagttgctggtatgatattgccctttattgttggt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2811113 |
cctaattggtttagagatggacatatctattgtgaaacgcaccggtgcaaaggcggtgtccattgcagttgctggtatgatattgccctttattgttggt |
2811212 |
T |
 |
| Q |
317 |
ttgggagtctcctttgctt |
335 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
2811213 |
ttgggagtctcctttgctt |
2811231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University