View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19673_low_16 (Length: 305)
Name: NF19673_low_16
Description: NF19673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19673_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 89; Significance: 6e-43; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 177 - 289
Target Start/End: Complemental strand, 5523792 - 5523677
Alignment:
| Q |
177 |
tgatttcgtcttatcttactaa--actaattaaataaatctgacaaaattaaacctttacctgaatagaccattttgtcttcctttgtt-ttttagggca |
273 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5523792 |
tgatttcgtcttatcttactaactagtaattaaataaatctgacaaaataaaacctttacctgaatagaccattttgtcttcctttgtttttttagggca |
5523693 |
T |
|
| Q |
274 |
ccatatatatgacaat |
289 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
5523692 |
ccatatatatgacaat |
5523677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 121 - 193
Target Start/End: Complemental strand, 5524006 - 5523934
Alignment:
| Q |
121 |
gttgtagtgagtgggagattcattttatttggaattggaatctacgggaagaacactgatttcgtcttatctt |
193 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5524006 |
gttgtagtgagtgggagattcatttcatttggaattggaatctacgggaagaacactgatttcgtcttatctt |
5523934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University