View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19673_low_17 (Length: 250)
Name: NF19673_low_17
Description: NF19673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19673_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 17 - 225
Target Start/End: Original strand, 43261179 - 43261386
Alignment:
| Q |
17 |
agatatgaagaactctaagccacatgcacgcaagcaacgtggaagttcttgtggtgaatattgcatggtgcaatatagtaaagatgagagtgtgatctag |
116 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43261179 |
agatatgaagaactctaagccacatgcacccaagcaacgtggaagttcttgtggtgaatattgcatggtgcaatatagtaaagatgagagtgtgatctag |
43261278 |
T |
 |
| Q |
117 |
ttctccaaccatgtttatacacgtaatatgatgaatcggataaggaatctcatgttattcccactgctgttacgtttttgttggtatactaaattgaaat |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43261279 |
ttctccaaccatgtttatacacgtaatatgatgaatcggataaggaatctcatgttattcccactgctgttacgtttttgttggtatac-aaattgaaat |
43261377 |
T |
 |
| Q |
217 |
gtaacttac |
225 |
Q |
| |
|
||||||||| |
|
|
| T |
43261378 |
gtaacttac |
43261386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University