View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19673_low_18 (Length: 248)
Name: NF19673_low_18
Description: NF19673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19673_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 19 - 237
Target Start/End: Complemental strand, 40639869 - 40639650
Alignment:
| Q |
19 |
aaacaccgctcaaatcaacgctagagtagattcaccttctttacggttttcatctttaaaccaactatacatgataataaaagggaaaacctattcataa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40639869 |
aaacaccgctcaaatcaacgctagagtagattcaccttctttacggttttcatctttaaaccaactatacatgataataaaagggaaaacctattcataa |
40639770 |
T |
 |
| Q |
119 |
tagaagtgttttatattattagc-nnnnnnntaagtactttatattattaacaaaataaataataagcgttttatccatctgcattagtcatgatagctc |
217 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40639769 |
tagaagtgttttatatcattagcaaaaaaaataagtactttatattattaacaaaataaataataagcgttttatccatctgcattagtcatgatagctc |
40639670 |
T |
 |
| Q |
218 |
atcaatggtggcaaattcat |
237 |
Q |
| |
|
|||||| ||||||||||||| |
|
|
| T |
40639669 |
atcaattgtggcaaattcat |
40639650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 187 - 237
Target Start/End: Complemental strand, 40643736 - 40643686
Alignment:
| Q |
187 |
ttttatccatctgcattagtcatgatagctcatcaatggtggcaaattcat |
237 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||| ||||| ||||||| |
|
|
| T |
40643736 |
ttttatccatctacattagtcatgatatctcatcaattgtggccaattcat |
40643686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University