View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19674_high_13 (Length: 217)

Name: NF19674_high_13
Description: NF19674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19674_high_13
NF19674_high_13
[»] chr1 (1 HSPs)
chr1 (20-203)||(36751885-36752068)


Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 20 - 203
Target Start/End: Complemental strand, 36752068 - 36751885
Alignment:
20 taagacttttcagtgtactaaaatcgaaataaaattacatgccgtgaaactttgcatgaaattaggggaataattgaagggagggcatgattgaaaaacc 119  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36752068 taagacttttcagtgtactaaaatcgaaataaaattacacgccgtgaaactttgcatgaaattaggggaataattgaagggagggcatgattgaaaaacc 36751969  T
120 cgtgcaaatgcttccaggattttctaatacagagaaagagacaattctatagaaaataacaacaaaagaatggacgaatgaagt 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36751968 cgtgcaaatgcttccaggattttctaatacagagaaagagacaattctatagaaaataacaacaaaagaatggacgaatgaagt 36751885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University