View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19674_high_14 (Length: 202)

Name: NF19674_high_14
Description: NF19674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19674_high_14
NF19674_high_14
[»] chr7 (2 HSPs)
chr7 (1-89)||(35762923-35763011)
chr7 (163-202)||(35763085-35763124)


Alignment Details
Target: chr7 (Bit Score: 89; Significance: 4e-43; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 35762923 - 35763011
Alignment:
1 cagaagaagcgttccgaggttgttcttgcttccacaagatatatccatacgcattgtacttgttttgtatttatagcacatgccacatg 89  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35762923 cagaagaagcgttccgaggttgttcttgcttccacaagatatatccatacgcattgtacttgttttgtatttatagcacatgccacatg 35763011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 163 - 202
Target Start/End: Original strand, 35763085 - 35763124
Alignment:
163 agtggatataaaatttgtacttaaattgctaaacgtggct 202  Q
    |||||||||||||||||||||||||||||||| |||||||    
35763085 agtggatataaaatttgtacttaaattgctaatcgtggct 35763124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University