View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19674_low_15 (Length: 202)
Name: NF19674_low_15
Description: NF19674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19674_low_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 89; Significance: 4e-43; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 35762923 - 35763011
Alignment:
| Q |
1 |
cagaagaagcgttccgaggttgttcttgcttccacaagatatatccatacgcattgtacttgttttgtatttatagcacatgccacatg |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35762923 |
cagaagaagcgttccgaggttgttcttgcttccacaagatatatccatacgcattgtacttgttttgtatttatagcacatgccacatg |
35763011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 163 - 202
Target Start/End: Original strand, 35763085 - 35763124
Alignment:
| Q |
163 |
agtggatataaaatttgtacttaaattgctaaacgtggct |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35763085 |
agtggatataaaatttgtacttaaattgctaatcgtggct |
35763124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University