View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19674_low_5 (Length: 739)
Name: NF19674_low_5
Description: NF19674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19674_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 3e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 3e-96
Query Start/End: Original strand, 506 - 720
Target Start/End: Original strand, 27307306 - 27307518
Alignment:
| Q |
506 |
ttgttaattagttttgaaaaaacacttaaaacatatccgaacattaaacacaaggatttctttggttgtacagataaaaatcagttttggatgatatcct |
605 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| | |
|
|
| T |
27307306 |
ttgttaattagttttgaaaaaacacttaaaacatatccgaacattaaacacaaggatttcttggcttgtacagataaaaatcagttttggatgatatctt |
27307405 |
T |
 |
| Q |
606 |
ccaacattatttttgtctcaatcaaagcttatttatatgacatcacaaagatcaaagacaacaacaattaatttgaagccaactaaacgatgaattaata |
705 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| |
|
|
| T |
27307406 |
c-aacattatttttgtctcaatcaaagcttatttatatgacatcacaaagatcaaagacaacagcaattaatttgaagccaactaaacgatgaatt-ata |
27307503 |
T |
 |
| Q |
706 |
tcacaaaacaaaatt |
720 |
Q |
| |
|
||| ||||||||||| |
|
|
| T |
27307504 |
tcagaaaacaaaatt |
27307518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University