View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19675_high_39 (Length: 334)
Name: NF19675_high_39
Description: NF19675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19675_high_39 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 1e-50; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 135 - 244
Target Start/End: Complemental strand, 44880171 - 44880062
Alignment:
| Q |
135 |
ctagggtgaggtcatagtgccttagtctaatttaaggaacgctttaggcttaaagcacactcacaaactatatttaccctttccaaagtagattaacatg |
234 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
44880171 |
ctagggtcaggtcatagtgccttagtctaatttaaggaacgctttaggcttaaagcacactcacaaattatatttaccctttccaaagtagattaacatg |
44880072 |
T |
 |
| Q |
235 |
gcttgaactc |
244 |
Q |
| |
|
|||||||||| |
|
|
| T |
44880071 |
gcttgaactc |
44880062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 229 - 334
Target Start/End: Complemental strand, 44880045 - 44879940
Alignment:
| Q |
229 |
aacatggcttgaactcaaaacgtacagatctaagacccaccctttattatttttgaatcaatagtttgtcnnnnnnnacctattattgataaatgttttt |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44880045 |
aacatggcttgaactcaaaacgtacagatctaagacccaccctttattatttttgaatcaatagtttgtctttttttacctattattgataaatgttttt |
44879946 |
T |
 |
| Q |
329 |
gatctc |
334 |
Q |
| |
|
|||||| |
|
|
| T |
44879945 |
gatctc |
44879940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 9 - 53
Target Start/End: Complemental strand, 44880297 - 44880253
Alignment:
| Q |
9 |
aagaatatttataattgaagattcggctggatattggatagagtg |
53 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
44880297 |
aagaatatttataattgaagattcggttggatattggatagagtg |
44880253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University