View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19675_high_45 (Length: 305)
Name: NF19675_high_45
Description: NF19675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19675_high_45 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 2 - 290
Target Start/End: Complemental strand, 47887230 - 47886942
Alignment:
| Q |
2 |
acagataaagattgggctcaaatgcagggaaagttccttctaaatgattccccctcaaaagtagttgtttatttggaaggcccccctggaggcactgaca |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47887230 |
acagataaagattgggctcaaatgcagggaaagttccttctaaatgattccccctcaaaagtagttgtttatttggaaggcccccctggaggcactgaca |
47887131 |
T |
 |
| Q |
102 |
ttcttctaaatacttttgttataaagcatgcagctaaatcaccaccttcgacacccccggattttgaggttaggctttcatcatattttctgcagattac |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47887130 |
ttcttctaaatacttttgttataaagcatgcagctaaatcaccaccttcgacacccccggattttgaggttaggctttcatcatattttctgcagattac |
47887031 |
T |
 |
| Q |
202 |
tttaatttctctttacacattcattgttactcaaacacttaattgtttctatgatgccttttgttgtgtggtcgattctgtatgcttca |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47887030 |
tttaatttctctttacacattcattgttactcaaacacttaattgtttctatgatgccttttgttgtgtggtcgattctgtatgcttca |
47886942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University