View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19675_high_65 (Length: 250)
Name: NF19675_high_65
Description: NF19675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19675_high_65 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 16 - 129
Target Start/End: Original strand, 1396096 - 1396209
Alignment:
| Q |
16 |
gtcgagttacttgttcgacaactaattctgaatgtcgctcgataggaattagtggtaatttattgatataggaagtgtcccaagtaagtttattgtgaag |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1396096 |
gtcgagttacttgttcgacaactaattctgaatgtggctcgataggaattagtggtaatttcttgatataggaagtgtcccaagtaagtttattgtgaag |
1396195 |
T |
|
| Q |
116 |
gaaaatgcactttc |
129 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
1396196 |
gaaaatgcactttc |
1396209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 175 - 238
Target Start/End: Original strand, 1396224 - 1396287
Alignment:
| Q |
175 |
cagtaatggttcgtgcccctaattagttgaaatgagtttacagtctcagtttctagacaatatt |
238 |
Q |
| |
|
|||||||||||| || |||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1396224 |
cagtaatggttcctgaccctaattagttgagatgagtttacagtctcagtttctagacaatatt |
1396287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University