View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19675_high_79 (Length: 232)
Name: NF19675_high_79
Description: NF19675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19675_high_79 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 15 - 217
Target Start/End: Original strand, 2487807 - 2488009
Alignment:
| Q |
15 |
ttattctaagctgcgtagaaatgcatcagcctctgcaaatattagcagcgttggttcgcaaagcaatcctacaaactcaggttacttcaataaaatattt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2487807 |
ttattctaagctgcgtagaaatgcatcagcctctgcaaatattagcagcattggtttgcaaagcaatcctacaaactcaggttacttcaataaaatattt |
2487906 |
T |
 |
| Q |
115 |
taaaagatcaattaggattttgaggttttgtttggtttacttgttgttaccatctgctggttatgtattgtttggtatgggaacctgatttaagaataca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2487907 |
taaaagatcaattaggattttgaggttttgtttggtttacttgttgttaccatctgctggttatgtattgtttggtatgggaacctgatttaagaataca |
2488006 |
T |
 |
| Q |
215 |
ttt |
217 |
Q |
| |
|
||| |
|
|
| T |
2488007 |
ttt |
2488009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University